Start a conversation

Synthetic Biology epistemology, SBOL and annotations

One of the hallmarks of synthetic biology is standardization [1] of both DNA parts and related data in order to ensure interoperability between systems, for search, integration and exchange. Data standardization and knowledge management ultimately go back to epistemology and theory of knowledge [2]. At DOULIX, we follow the path of constructivist epistemology after the teaching of Piaget [3], Maturana and Varela, and, within Synthetic Biology, Luisi [4 ]. We assume that knowledge expresses our understanding of a specific object at a specific time and necessarily reflects our cognitive pattern and cultural background.

Within this framework, DOULIX is based on some assumptions:

  • The object. The object of knowledge is the entity under observation. In DOULIX, this object is any DNA or amino acid sequences and it is captured and stored as a Biomodule. For instance, the sequence TAATACGACTCACTATAGGGAATACAAGCTACTTGTTCTTTTTGCA is an object and it is stored as biomodule 716RON, regardless of its potential or actual function.
  • Object attributes.  Attributes define the features of objects and they are abstractions that should reflect what we think the object can do. In DOULIX, attributes are represented by annotations of biological functions appended to a DNA or amino acid sequence. For instance, the biomodule MGEC526 is annotated as promoter from nt 295 to nt 351 and as coding sequence from nt 484 to nt 1443. It should be noted that attributes/annotations are an observer-dependent description of the object with different degrees of validity and accuracy.

This epistemological and theoretical framework shaped the way we designed and implemented DOULIX's data structure and algorithms.  For instance, in DOULIX biological functions are linked to annotations rather than sequences. Annotations work as an intermediate layer that links biological functions to sequences. This approach comes in handy when modifying or engineering sequences that are linked to multiple biological functions. Since each function is linked to a given annotation any change/deletion in the DNA sequence spanning that annotation will affect also the corresponding biological function. This allows the automatic updating of biological functions of DOULIX’s entries.  

For instance, if one deleted the region between nt 295 and nt 351 from biomodule MGEC526, the correspondent list of associated functions would be automatically updated by removing the promoter function. This unsupervised maintenance would be difficult if the biological function (i.e. DNA sequence promoting the initiation of RNA transcription) were associated directly to the object (i.e. the DNA sequence) rather than to its attribute (i.e. annotation promoter).

One these premises, we built DOULIX with its repositories, sequence designer and modeling algorithms. Naturally, the principles above are not sufficient to account for the extraordinary complexity found in biology. This document simply introduces our contribution to (and defines where we stand in) the current epistemological debate in synthetic biology.

 In this article, we provide the essential reference to map DOULIX's biological annotations to Sequence Ontology terms (SO) and SBOL Visual (SBOL). Whenever possible, we try to comply with both standards. 


Doulix Annotation
SO term
SBOL tem
Visual
Promoter/Operator
SO:0000167
SO:0000409
Promotor site
Operator binding site

5'-UTR
SO:0000204
n.a.

Coding Sequence
SO:0000316
CDS

3'-UTR
SO:0000205
n.a.

Terminator
SO:0000141
Terminator

Plasmid Backbone
SO:0000755
n.a.

non-coding RNA
SO:0001263
Non-Coding RNA Gene

Composite
n.a.
Composite

Unknown/Other
SO:0000110
Unspecified

Hinge/Restriction site
SO:0001687
DNA cleavage site

Primer/Oligo/Probe
SO:0005850
Primer binding site


We will keep adding new annotations in the next months, stay tuned!


References

  1. Drew Endy. Foundations for engineering biology. Nature, Vol 438 (24). 2005.
  2. Carl J. Wenning Scientific epistemology: How scientists know what they know. J. Phys. Tchr. Educ. Online, 5 (2). 2009.
  3. Ernst von Glasersfeld. An Exposition of Constructivism: Why Some Like it Radical. Ed. Massachusetts Univ., Amherst. Scientific Reasoning Research Institute. 1990.
  4. Humberto R. Maturana, Michel Bitbol & Pier Luigi Luisi. The Transcendence of the Observer. Constructivist Foundations, 7, 2012.


Acknowledgment

Credits to Stefano Maria Marino and Serena Marletta from Explora Biotech for their contributions to the ideas discussed here. Special thanks to Luisa Damiano (Univ. of Messina, Italy) and Marco Rugliancich for the fruitful discussions.

Choose files or drag and drop files
Was this article helpful?
Yes
No
  1. Davide De Lucrezia

  2. Posted
  3. Updated

Comments